Skip to content
Open
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
16 changes: 0 additions & 16 deletions .tt_blacklist
Original file line number Diff line number Diff line change
Expand Up @@ -129,22 +129,6 @@ tool_collections/vcftools/vcftools_merge
tool_collections/vcftools/vcftools_subset
tool_collections/vcftools/vcftools_annotate
tool_collections/vcftools/vcftools_isec
tool_collections/fastx_toolkit/fastq_quality_converter
tool_collections/fastx_toolkit/fasta_clipping_histogram
tool_collections/fastx_toolkit/fastx_nucleotides_distribution
tool_collections/fastx_toolkit/fastx_trimmer
tool_collections/fastx_toolkit/fastx_clipper
tool_collections/fastx_toolkit/fastx_artifacts_filter
tool_collections/fastx_toolkit/fastx_barcode_splitter
tool_collections/fastx_toolkit/fastq_quality_filter
tool_collections/fastx_toolkit/fastx_renamer
tool_collections/fastx_toolkit/fastx_quality_statistics
tool_collections/fastx_toolkit/fasta_formatter
tool_collections/fastx_toolkit/fastq_quality_boxplot
tool_collections/fastx_toolkit/fasta_nucleotide_changer
tool_collections/fastx_toolkit/fastq_to_fasta
tool_collections/fastx_toolkit/fastx_collapser
tool_collections/fastx_toolkit/fastx_reverse_complement
tool_collections/gatk/variant_annotator
tool_collections/gatk/variant_apply_recalibration
tool_collections/gatk/count_covariates
Expand Down
Original file line number Diff line number Diff line change
@@ -1,18 +1,25 @@
<tool id="cshl_fasta_clipping_histogram" name="Length Distribution" version="1.0.0">
<tool id="cshl_fasta_clipping_histogram" name="Length Distribution" version="@VERSION@">

Copy link
Copy Markdown
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I wonder if this would cause problems, unless the version lineage code recognizes that 0.0.14 > 1.0.0

Copy link
Copy Markdown
Member Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Oh yes, this is true. Too bad. Are you working on this?

Copy link
Copy Markdown
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I was planning on moving it to IUC in galaxyproject/tools-iuc#1413, and of course I can merge in your changes there to avoid reinventing effort.

Copy link
Copy Markdown
Member Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

cool, please go ahead and close this when you are ready.

<description>chart</description>
<requirements>
<requirement type="package" version="0.0.13">fastx_toolkit</requirement>
</requirements>
<command>fasta_clipping_histogram.pl $input $outfile</command>

<expand macro="requirements" />
<macros>
<import>fastx_macros.xml</import>
</macros>
<command><![CDATA[
command -v perl5.22.0 &&
perl5.22.0 `command -v fasta_clipping_histogram.pl` '$input' '$outfile' ||
fasta_clipping_histogram.pl '$input' '$outfile'
]]></command>
<inputs>
<param format="fasta" name="input" type="data" label="Library to analyze" />
</inputs>

<outputs>
<data format="png" name="outfile" metadata_source="input" />
</outputs>
<tests>
<test>

Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

@bgruening unfortunately this test only passes if I set galaxy's conda version to 4.2.7 :(.
Otherwise I'm getting fastx_toolkit==0.0.14-2 instead of -3. See https://travis-ci.org/galaxyproject/tools-devteam/jobs/160679791#L355

Copy link
Copy Markdown
Member Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Urgs, this offline bug needs to be fixed. This is really killing us.

<param name="input" value="input.fasta" ftype="fasta"/>
<output name="outfile" file="histogram.pdf" />
</test>
</tests>
<help>
**What it does**
Expand Down
Original file line number Diff line number Diff line change
@@ -0,0 +1,6 @@
>sequence1
AGTAGTAGGTGATGTAGAGAGAGAGAGAGTAG
>sequence2
GTGTGTGTGGGAAGTTGACACAGTA
>sequence3
CCTTGAGATTAACGCTAATCAAGTAAAC

This file was deleted.

Original file line number Diff line number Diff line change
@@ -1,8 +1,9 @@
<tool id="cshl_fasta_formatter" version="1.0.0" name="FASTA Width">
<tool id="cshl_fasta_formatter" version="@VERSION@" name="FASTA Width">
<description>formatter</description>
<requirements>
<requirement type="package" version="0.0.13">fastx_toolkit</requirement>
</requirements>
<expand macro="requirements" />
<macros>
<import>fastx_macros.xml</import>
</macros>
<!--
Note:
fasta_formatter also has a tabular output mode (-t),
Expand All @@ -13,9 +14,9 @@
FASTA file.
-->
<command>
<![CDATA[
zcat -f < '$input' | fasta_formatter -w $width -o '$output'
]]>
<![CDATA[
zcat -f < '$input' | fasta_formatter -w $width -o '$output'
]]>
</command>
<inputs>
<param format="fasta" name="input" type="data" label="Library to re-format" />
Expand Down

This file was deleted.

Original file line number Diff line number Diff line change
@@ -1,12 +1,13 @@
<tool id="cshl_fasta_nucleotides_changer" version="1.0.0" name="RNA/DNA" >
<tool id="cshl_fasta_nucleotides_changer" version="@VERSION@" name="RNA/DNA" >
<description>converter</description>
<requirements>
<requirement type="package" version="0.0.13">fastx_toolkit</requirement>
</requirements>
<expand macro="requirements" />
<macros>
<import>fastx_macros.xml</import>
</macros>
<command>
<![CDATA[
zcat -f < '$input' | fasta_nucleotide_changer -$mode -v -o '$output'
]]>
<![CDATA[
zcat -f < '$input' | fasta_nucleotide_changer -$mode -v -o '$output'
]]>
</command>
<inputs>
<param format="fasta" name="input" type="data" label="Library to convert" />
Expand Down
Original file line number Diff line number Diff line change
@@ -1,17 +1,25 @@
<tool id="cshl_fastq_quality_boxplot" name="Draw quality score boxplot" version="1.0.0">
<description></description>
<requirements>
<requirement type="package" version="0.0.13">fastx_toolkit</requirement>
</requirements>
<command>fastq_quality_boxplot_graph.sh -t '$input.name' -i $input -o $output</command>

<inputs>
<param format="txt" name="input" type="data" label="Statistics report file" help="output of 'FASTQ Statistics' tool" />
</inputs>

<outputs>
<data format="png" name="output" metadata_source="input" />
</outputs>
<tool id="cshl_fastq_quality_boxplot" name="Draw quality score boxplot" version="@VERSION@">
<description></description>
<expand macro="requirements" />
<macros>
<import>fastx_macros.xml</import>
</macros>
<command>
fastq_quality_boxplot_graph.sh -t '$input.name' -i '$input' -o '$output'
</command>
<inputs>
<param format="txt" name="input" type="data" label="Statistics report file" help="output of 'FASTQ Statistics' tool" />
</inputs>

<outputs>
<data format="png" name="output" metadata_source="input" />
</outputs>
<tests>
<test>
<param name="input" value="fastq_stats1.out" ftype="txt"></param>
<output name="output" file="quality_boxplot_out.png"></output>
</test>
</tests>
<help>

**What it does**
Expand Down
Original file line number Diff line number Diff line change
@@ -0,0 +1,37 @@
column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count Max_count
1 9 23 34 288 32.00 33 33 33 0 33 33 3 1 4 1 0 9
2 9 28 33 287 31.89 31 33 33 2 28 33 3 3 2 1 0 9
3 9 13 34 268 29.78 28 33 33 5 21 34 5 1 0 3 0 9
4 9 17 33 261 29.00 30 33 33 3 26 33 1 2 3 3 0 9
5 9 22 33 269 29.89 30 33 33 3 26 33 3 3 3 0 0 9
6 9 22 33 277 30.78 30 33 33 3 26 33 5 3 0 1 0 9
7 9 21 33 258 28.67 24 33 33 9 21 33 4 1 3 1 0 9
8 9 12 33 263 29.22 32 33 33 1 31 33 2 1 1 5 0 9
9 9 29 33 290 32.22 33 33 33 0 33 33 3 3 2 1 0 9
10 9 23 33 277 30.78 32 33 33 1 31 33 1 4 2 2 0 9
11 9 12 33 245 27.22 21 31 33 12 12 33 5 2 1 1 0 9
12 9 13 33 214 23.78 15 24 33 18 13 33 2 4 2 1 0 9
13 9 5 33 249 27.67 29 31 33 4 23 33 2 1 1 5 0 9
14 9 5 33 233 25.89 24 33 33 9 11 33 3 3 2 1 0 9
15 9 15 33 251 27.89 24 33 33 9 15 33 5 1 1 2 0 9
16 9 23 34 269 29.89 24 33 33 9 23 34 3 1 2 3 0 9
17 9 13 34 266 29.56 33 33 33 0 33 33 2 3 1 3 0 9
18 9 21 34 272 30.22 31 33 33 2 28 34 0 5 1 3 0 9
19 9 5 34 244 27.11 27 30 33 6 18 34 4 4 1 0 0 9
20 9 11 34 241 26.78 23 32 33 10 11 34 3 4 2 0 0 9
21 9 13 33 240 26.67 24 27 33 9 13 33 1 4 0 4 0 9
22 9 5 33 190 21.11 13 21 33 20 5 33 1 4 0 3 1 9
23 9 5 33 205 22.78 16 26 33 17 5 33 4 4 1 0 0 9
24 9 5 33 247 27.44 28 31 33 5 21 33 1 5 1 2 0 9
25 9 11 34 241 26.78 24 33 33 9 11 34 3 4 0 2 0 9
26 9 5 33 212 23.56 18 31 33 15 5 33 0 6 0 3 0 9
27 9 5 33 227 25.22 21 26 33 12 5 33 3 4 1 1 0 9
28 9 21 33 255 28.33 24 31 33 9 21 33 2 4 3 0 0 9
29 9 5 33 228 25.33 21 30 33 12 5 33 2 4 1 2 0 9
30 9 10 33 213 23.67 16 28 33 17 10 33 3 4 2 0 0 9
31 9 5 33 236 26.22 21 31 33 12 5 33 1 4 1 3 0 9
32 9 5 33 210 23.33 12 29 33 21 5 33 3 3 0 3 0 9
33 9 5 33 183 20.33 9 21 33 24 5 33 1 4 2 2 0 9
34 9 5 33 150 16.67 7 17 22 15 5 33 3 4 1 1 0 9
35 9 13 33 217 24.11 21 24 29 8 13 33 1 4 1 3 0 9
36 9 5 33 195 21.67 18 21 32 14 5 33 3 2 1 3 0 9
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.

This file was deleted.

Original file line number Diff line number Diff line change
@@ -1,8 +1,9 @@
<tool id="cshl_fastq_quality_converter" name="Quality format converter" version="1.0.0">
<tool id="cshl_fastq_quality_converter" name="Quality format converter" version="@VERSION@">
<description>(ASCII-Numeric)</description>
<requirements>
<requirement type="package" version="0.0.13">fastx_toolkit</requirement>
</requirements>
<expand macro="requirements" />
<macros>
<import>fastx_macros.xml</import>
</macros>
<command>
<![CDATA[
zcat -f < '$input' | fastq_quality_converter $QUAL_FORMAT -o '$output' -Q $offset
Expand Down

This file was deleted.

Original file line number Diff line number Diff line change
@@ -1,15 +1,19 @@
<tool id="cshl_fastq_quality_filter" version="1.0.0" name="Filter by quality">
<tool id="cshl_fastq_quality_filter" version="@VERSION@" name="Filter by quality">
<description></description>
<requirements>
<requirement type="package" version="0.0.13">fastx_toolkit</requirement>
</requirements>
<expand macro="requirements" />
<macros>
<import>fastx_macros.xml</import>
</macros>
<command>
<![CDATA[
zcat -f < '$input' | fastq_quality_filter -q $quality -p $percent -v -o '$output'
#if $input.ext == "fastqsanger":
-Q 33
#end if
]]>
<![CDATA[
zcat -f < '$input' | fastq_quality_filter -q $quality -p $percent -v -o '$output'
## fastqsanger uses offset 33, illumina and solexa offset 64 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2847217/table/T1/)
#if $input.is_of_type(fastqsanger):
-Q 33
#elif $input.is_of_type(fastqillumina" or $input.is_of_type(fastqsolexa):
-Q 64
#end if
]]>
</command>

<inputs>
Expand Down

This file was deleted.

97 changes: 51 additions & 46 deletions tool_collections/fastx_toolkit/fastq_to_fasta/fastq_to_fasta.xml
Original file line number Diff line number Diff line change
@@ -1,49 +1,54 @@
<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA" version="1.0.0">
<description>converter from FASTX-toolkit</description>
<requirements>
<requirement type="package" version="0.0.13">fastx_toolkit</requirement>
</requirements>
<command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v
#if $input.ext == "fastqsanger":
-Q 33
#end if
</command>

<inputs>
<param format="fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="FASTQ Library to convert" />

<param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
<option value="">yes</option>
<option value="-n">no</option>
</param>

<param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
<option value="-r">yes</option>
<option value="">no</option>
</param>

</inputs>

<tests>
<test>
<!-- FASTQ-To-FASTA, keep N, don't rename -->
<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
<param name="SKIPN" value=""/>
<param name="RENAMESEQ" value=""/>
<output name="output" file="fastq_to_fasta1a.out" />
</test>
<test>
<!-- FASTQ-To-FASTA, discard N, rename -->
<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
<param name="SKIPN" value="no"/>
<param name="RENAMESEQ" value="yes"/>
<output name="output" file="fastq_to_fasta1b.out" />
</test>
</tests>

<outputs>
<data format="fasta" name="output" metadata_source="input" />
</outputs>
<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA" version="@VERSION@">
<description>converter from FASTX-toolkit</description>
<expand macro="requirements" />
<macros>
<import>fastx_macros.xml</import>
</macros>
<command>
<![CDATA[
gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v
#if $input.is_of_type('fastqsanger'):
-Q 33
#elif $input.is_of_type('fastqillumina') or $input.is_of_type('fastqsolexa'):
-Q 64
#end if
]]>
</command>
<inputs>
<param format="fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="FASTQ Library to convert" />

<param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
<option value="">yes</option>
<option value="-n">no</option>
</param>

<param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
<option value="-r">yes</option>
<option value="">no</option>
</param>

</inputs>

<tests>
<test>
<!-- FASTQ-To-FASTA, keep N, don't rename -->
<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
<param name="SKIPN" value=""/>
<param name="RENAMESEQ" value=""/>
<output name="output" file="fastq_to_fasta1a.out" />
</test>
<test>
<!-- FASTQ-To-FASTA, discard N, rename -->
<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
<param name="SKIPN" value="no"/>
<param name="RENAMESEQ" value="yes"/>
<output name="output" file="fastq_to_fasta1b.out" />
</test>
</tests>

<outputs>
<data format="fasta" name="output" metadata_source="input" />
</outputs>

<help>

Expand Down

This file was deleted.

Loading