-
Notifications
You must be signed in to change notification settings - Fork 94
WIP: Update and test fastx-tools #375
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
base: main
Are you sure you want to change the base?
Changes from all commits
a81f7d5
a554313
459ff1c
8865acd
0c1f99d
f4e5d27
f206706
361f286
0024992
3fdc28d
d55db72
f9a5168
File filter
Filter by extension
Conversations
Jump to
Diff view
Diff view
There are no files selected for viewing
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1,18 +1,25 @@ | ||
| <tool id="cshl_fasta_clipping_histogram" name="Length Distribution" version="1.0.0"> | ||
| <tool id="cshl_fasta_clipping_histogram" name="Length Distribution" version="@VERSION@"> | ||
| <description>chart</description> | ||
| <requirements> | ||
| <requirement type="package" version="0.0.13">fastx_toolkit</requirement> | ||
| </requirements> | ||
| <command>fasta_clipping_histogram.pl $input $outfile</command> | ||
|
|
||
| <expand macro="requirements" /> | ||
| <macros> | ||
| <import>fastx_macros.xml</import> | ||
| </macros> | ||
| <command><![CDATA[ | ||
| command -v perl5.22.0 && | ||
| perl5.22.0 `command -v fasta_clipping_histogram.pl` '$input' '$outfile' || | ||
| fasta_clipping_histogram.pl '$input' '$outfile' | ||
| ]]></command> | ||
| <inputs> | ||
| <param format="fasta" name="input" type="data" label="Library to analyze" /> | ||
| </inputs> | ||
|
|
||
| <outputs> | ||
| <data format="png" name="outfile" metadata_source="input" /> | ||
| </outputs> | ||
| <tests> | ||
| <test> | ||
|
Member
There was a problem hiding this comment. Choose a reason for hiding this commentThe reason will be displayed to describe this comment to others. Learn more. @bgruening unfortunately this test only passes if I set galaxy's conda version to 4.2.7 :(.
Member
Author
There was a problem hiding this comment. Choose a reason for hiding this commentThe reason will be displayed to describe this comment to others. Learn more. Urgs, this offline bug needs to be fixed. This is really killing us. |
||
| <param name="input" value="input.fasta" ftype="fasta"/> | ||
| <output name="outfile" file="histogram.pdf" /> | ||
| </test> | ||
| </tests> | ||
| <help> | ||
| **What it does** | ||
|
|
||
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1 @@ | ||
| ../fastx_macros.xml |
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,6 @@ | ||
| >sequence1 | ||
| AGTAGTAGGTGATGTAGAGAGAGAGAGAGTAG | ||
| >sequence2 | ||
| GTGTGTGTGGGAAGTTGACACAGTA | ||
| >sequence3 | ||
| CCTTGAGATTAACGCTAATCAAGTAAAC |
This file was deleted.
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1 @@ | ||
| ../fastx_macros.xml |
This file was deleted.
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1 @@ | ||
| ../fastx_macros.xml |
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1 @@ | ||
| ../fastx_macros.xml |
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,37 @@ | ||
| column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count Max_count | ||
| 1 9 23 34 288 32.00 33 33 33 0 33 33 3 1 4 1 0 9 | ||
| 2 9 28 33 287 31.89 31 33 33 2 28 33 3 3 2 1 0 9 | ||
| 3 9 13 34 268 29.78 28 33 33 5 21 34 5 1 0 3 0 9 | ||
| 4 9 17 33 261 29.00 30 33 33 3 26 33 1 2 3 3 0 9 | ||
| 5 9 22 33 269 29.89 30 33 33 3 26 33 3 3 3 0 0 9 | ||
| 6 9 22 33 277 30.78 30 33 33 3 26 33 5 3 0 1 0 9 | ||
| 7 9 21 33 258 28.67 24 33 33 9 21 33 4 1 3 1 0 9 | ||
| 8 9 12 33 263 29.22 32 33 33 1 31 33 2 1 1 5 0 9 | ||
| 9 9 29 33 290 32.22 33 33 33 0 33 33 3 3 2 1 0 9 | ||
| 10 9 23 33 277 30.78 32 33 33 1 31 33 1 4 2 2 0 9 | ||
| 11 9 12 33 245 27.22 21 31 33 12 12 33 5 2 1 1 0 9 | ||
| 12 9 13 33 214 23.78 15 24 33 18 13 33 2 4 2 1 0 9 | ||
| 13 9 5 33 249 27.67 29 31 33 4 23 33 2 1 1 5 0 9 | ||
| 14 9 5 33 233 25.89 24 33 33 9 11 33 3 3 2 1 0 9 | ||
| 15 9 15 33 251 27.89 24 33 33 9 15 33 5 1 1 2 0 9 | ||
| 16 9 23 34 269 29.89 24 33 33 9 23 34 3 1 2 3 0 9 | ||
| 17 9 13 34 266 29.56 33 33 33 0 33 33 2 3 1 3 0 9 | ||
| 18 9 21 34 272 30.22 31 33 33 2 28 34 0 5 1 3 0 9 | ||
| 19 9 5 34 244 27.11 27 30 33 6 18 34 4 4 1 0 0 9 | ||
| 20 9 11 34 241 26.78 23 32 33 10 11 34 3 4 2 0 0 9 | ||
| 21 9 13 33 240 26.67 24 27 33 9 13 33 1 4 0 4 0 9 | ||
| 22 9 5 33 190 21.11 13 21 33 20 5 33 1 4 0 3 1 9 | ||
| 23 9 5 33 205 22.78 16 26 33 17 5 33 4 4 1 0 0 9 | ||
| 24 9 5 33 247 27.44 28 31 33 5 21 33 1 5 1 2 0 9 | ||
| 25 9 11 34 241 26.78 24 33 33 9 11 34 3 4 0 2 0 9 | ||
| 26 9 5 33 212 23.56 18 31 33 15 5 33 0 6 0 3 0 9 | ||
| 27 9 5 33 227 25.22 21 26 33 12 5 33 3 4 1 1 0 9 | ||
| 28 9 21 33 255 28.33 24 31 33 9 21 33 2 4 3 0 0 9 | ||
| 29 9 5 33 228 25.33 21 30 33 12 5 33 2 4 1 2 0 9 | ||
| 30 9 10 33 213 23.67 16 28 33 17 10 33 3 4 2 0 0 9 | ||
| 31 9 5 33 236 26.22 21 31 33 12 5 33 1 4 1 3 0 9 | ||
| 32 9 5 33 210 23.33 12 29 33 21 5 33 3 3 0 3 0 9 | ||
| 33 9 5 33 183 20.33 9 21 33 24 5 33 1 4 2 2 0 9 | ||
| 34 9 5 33 150 16.67 7 17 22 15 5 33 3 4 1 1 0 9 | ||
| 35 9 13 33 217 24.11 21 24 29 8 13 33 1 4 1 3 0 9 | ||
| 36 9 5 33 195 21.67 18 21 32 14 5 33 3 2 1 3 0 9 |
This file was deleted.
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1 @@ | ||
| ../fastx_macros.xml |
This file was deleted.
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1 @@ | ||
| ../fastx_macros.xml |
This file was deleted.
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1 @@ | ||
| ../fastx_macros.xml |
This file was deleted.
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
I wonder if this would cause problems, unless the version lineage code recognizes that 0.0.14 > 1.0.0
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
Oh yes, this is true. Too bad. Are you working on this?
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
I was planning on moving it to IUC in galaxyproject/tools-iuc#1413, and of course I can merge in your changes there to avoid reinventing effort.
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
cool, please go ahead and close this when you are ready.